Which enzymes are included?

A curated common subset: EcoRI, BamHI, HindIII, NotI, XhoI, PstI, SalI, NdeI, SmaI and KpnI. This is not the full enzyme universe — for that, consult REBASE.

Does it consider the reverse strand?

All curated enzymes have palindromic recognition sites, so a hit on the top strand is also a hit on the bottom strand at the same position. Non-palindromic enzymes are not included in this subset.

Restriction enzyme cutter

Scan a DNA sequence for cut sites of a curated set of common restriction enzymes (EcoRI, BamHI, HindIII, NotI and more), with position and cut offset.

How it works

Formula

For each enzyme, scan the sequence for its recognition site and report the 0-based occurrence as a 1-based position plus the top-strand cut offset. All curated enzymes recognise palindromic sites, so both strands cut at the reported position.

Worked example

GAATTCAAGCTTGGATCCCTGCAG contains EcoRI (GAATTC, cuts after base 1), HindIII (AAGCTT, after base 7), BamHI (GGATCC, after base 13) and PstI (CTGCAG, after base 23).

When to use it

To plan a cloning digest, check whether an enzyme cuts your insert or vector, or confirm a site is present (or absent) before ordering enzymes.

Sensible defaults

The default sequence contains four common sites. Paste your own sequence to scan it against the curated enzyme set.

Source

Curated common subset, NOT exhaustive. Recognition sequences and cut positions are standard, well-documented biology (NEB catalogue); the complete database is REBASE (http://rebase.neb.com).

FAQ

Which enzymes are included?: A curated common subset: EcoRI, BamHI, HindIII, NotI, XhoI, PstI, SalI, NdeI, SmaI and KpnI. This is not the full enzyme universe — for that, consult REBASE.
Does it consider the reverse strand?: All curated enzymes have palindromic recognition sites, so a hit on the top strand is also a hit on the bottom strand at the same position. Non-palindromic enzymes are not included in this subset.